Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CREB1(1385)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Supriya Srinivasan et al.
Cancer research, 78(21), 6146-6158 (2018-09-21)
Although smoking is a significant risk factor for pancreatic ductal adenocarcinoma (PDAC), the molecular mechanisms underlying PDAC development and progression in smokers are still unclear. Here, we show the role of cyclic AMP response element-binding protein (CREB) in the pathogenesis
Hui-Xia Geng et al.
Neurochemical research, 42(10), 2841-2849 (2017-05-17)
Neuronal apoptosis mediated by the mitochondrial apoptosis pathway is an important pathological process in cerebral ischemia-reperfusion injury. 14,15-EET, an intermediate metabolite of arachidonic acid, can promote cell survival during ischemia/reperfusion. However, whether the mitochondrial apoptotic pathway is involved this survival
L Yuan et al.
Neuropathology and applied neurobiology, 42(7), 607-620 (2015-11-04)
14,15-Epoxyeicosatrienoic acid (14,15-EET) is abundantly expressed in brain and exerts protective effects against ischaemia. 14,15-EET is hydrolysed by soluble epoxide hydrolase (sEH). sEH-/- mice show a higher level of 14,15-EET in the brain. Astrocytes play a pivotal role in neuronal