Skip to Content
Merck

EHU095161

MISSION® esiRNA

targeting human NCAM1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAAGATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGAAGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACACAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTACCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAATCCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NCAM1(4684)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yongguang Yang et al.
BMC cell biology, 11, 78-78 (2010-10-20)
The proliferation and final density of Sertoli cells in the testis are regulated by hormones and local factors. Glial cell line-derived neurotrophic factor (GDNF), a distantly related member of the transforming growth factor-β superfamily, and its receptor subunits GDNF family
Chunlei Yu et al.
Toxicology mechanisms and methods, 26(9), 635-643 (2016-11-08)
Curcuma phaeocaulis Val. is a Chinese medicinal herb that is contraindicated during pregnancy for over a thousand years in China. The aims of the present study were to evaluate the effect of curcumol (one of the major components of C.
Natacha Coppieters et al.
Brain research, 1710, 199-208 (2018-12-26)
The neural cell adhesion molecule (NCAM) is a transmembrane protein involved in major cellular processes. The addition of polysialic acid (PSA), a post-translational modification (PTM) almost exclusively carried by NCAM, alters NCAM properties and functions and is therefore tightly regulated.