Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGCCACCATGAAGACTTTGCTTAGAACTTGGTCAGAATTATATAGAGCATTTGCTCGTTGTGCTGCTTTGGTGGCAACAGCAGAAGAGAACTTGTGCTGTGAGGAACTTTCTTCCAAGATAATGTCCAGTTTGGAAGATGAAGGCTTTTCTAATTTGTTGTTCGTGGATAGAATTATTTATATTATTACTGTAATGGTTGATTGCATTGACTTCTCACCATATAATATTAAATATCAGCCCAAAGTTAAATCACCACAGAGACCTTCAGATTGGTCCAAAAAGAAGAATGAGCCCCTAGGGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RIF1(55183)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sylvie M Noordermeer et al.
Nature, 560(7716), 117-121 (2018-07-20)
53BP1 is a chromatin-binding protein that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini1,2. This function of 53BP1 requires interactions with PTIP3 and RIF14-9, the latter of which recruits REV7 (also known as
Shin-Ichiro Hiraga et al.
EMBO reports, 18(3), 403-419 (2017-01-13)
The human RIF1 protein controls DNA replication, but the molecular mechanism is largely unknown. Here, we demonstrate that human RIF1 negatively regulates DNA replication by forming a complex with protein phosphatase 1 (PP1) that limits phosphorylation-mediated activation of the MCM
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin