Skip to Content
Merck

EHU100071

MISSION® esiRNA

targeting human NUAK1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCATCACCACAAGCACAACTTGAAGCACCGCTACGAGCTGCAGGAGACCCTGGGCAAAGGCACCTACGGCAAAGTCAAGCGGGCCACCGAGAGGTTTTCTGGCCGAGTGGTTGCTATAAAATCCATTCGTAAGGACAAAATTAAGGATGAACAAGACATGGTTCACATCAGACGAGAGATTGAGATCATGTCATCTCTCAACCATCCTCATATCATCAGTATTTATGAAGTGTTTGAGAACAAAGATAAGATTGTGATCATCATGGAATATGCCAGCAAAGGGGAGCTGTACGATTACATCAGTGAGCGGCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NUAK1(9891)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Minghui Li et al.
American journal of translational research, 9(4), 1708-1719 (2017-05-05)
Lung cancer incidence and mortality rates are amongst the highest of all malignant tumors worldwide. ARK5 is a member of the human AMP-activated protein kinase (AMPK) family which is implicated in tumor survival and progression. The current study was designed
Ji Kui Peng et al.
Oncology letters, 15(3), 3639-3645 (2018-02-23)
Hypoxia is a common characteristic of solid tumors. Previous studies have reported that the tumor invasion-associated factor, AMPK-related protein kinase 5 (ARK5), is associated with a poor prognosis in colon cancer. However, whether or not ARK5 is involved in hypoxia
Emilia Escalona et al.
Frontiers in oncology, 10, 1123-1123 (2020-08-06)
NUAK1 is an AMPK-related kinase located in the cytosol and the nucleus, whose expression associates with tumor malignancy and poor patient prognosis in several cancers. Accordingly, NUAK1 was associated with metastasis because it promotes cell migration and invasion in different