Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCATCACCACAAGCACAACTTGAAGCACCGCTACGAGCTGCAGGAGACCCTGGGCAAAGGCACCTACGGCAAAGTCAAGCGGGCCACCGAGAGGTTTTCTGGCCGAGTGGTTGCTATAAAATCCATTCGTAAGGACAAAATTAAGGATGAACAAGACATGGTTCACATCAGACGAGAGATTGAGATCATGTCATCTCTCAACCATCCTCATATCATCAGTATTTATGAAGTGTTTGAGAACAAAGATAAGATTGTGATCATCATGGAATATGCCAGCAAAGGGGAGCTGTACGATTACATCAGTGAGCGGCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NUAK1(9891)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Minghui Li et al.
American journal of translational research, 9(4), 1708-1719 (2017-05-05)
Lung cancer incidence and mortality rates are amongst the highest of all malignant tumors worldwide. ARK5 is a member of the human AMP-activated protein kinase (AMPK) family which is implicated in tumor survival and progression. The current study was designed
Ji Kui Peng et al.
Oncology letters, 15(3), 3639-3645 (2018-02-23)
Hypoxia is a common characteristic of solid tumors. Previous studies have reported that the tumor invasion-associated factor, AMPK-related protein kinase 5 (ARK5), is associated with a poor prognosis in colon cancer. However, whether or not ARK5 is involved in hypoxia
Emilia Escalona et al.
Frontiers in oncology, 10, 1123-1123 (2020-08-06)
NUAK1 is an AMPK-related kinase located in the cytosol and the nucleus, whose expression associates with tumor malignancy and poor patient prognosis in several cancers. Accordingly, NUAK1 was associated with metastasis because it promotes cell migration and invasion in different