Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCAGAGGCTCTTCATGATTCTTTGGCTCAAAGGAGTTGTATTTAGTGTGACGACTGTTGACCTGAAAAGGAAGCCAGCAGACCTGCAGAACTTGGCTCCCGGGACCCACCCACCATTTATAACTTTCAACAGTGAAGTCAAAACGGATGTAAATAAGATTGAGGAATTTCTTGAAGAAGTCTTATGCCCTCCCAAGTACTTAAAGCTTTCACCAAAACACCCAGAATCAAATACTGCTGGAATGGACATCTTTGCCAAATTCTCTGCATATATCAAGAATTCAAGGCCAGAGGCTAATGAAGCACTGGAGAGGGGTCTCCTGAAAACCCTGCAGAAACTGGATGAATATCTGAATTCTCCTCTCCCTGATGAAATTGATGAAAATAGTATGGAGGACATAAAGTTTTCTACACGTAAATTTCTGGATGGCAATGAAATGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CLIC4(25932)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qiu-Yun Yu et al.
Journal of cellular biochemistry, 119(1), 659-668 (2017-06-22)
This study explored the effects involved in silencing CLIC4 on apoptosis and proliferation of mouse liver cancer Hca-F and Hca-P cells. A CLIC4-target small interfering RNA (siRNA) was designed to compound into two individual complementary oligonucleotide chains. A process of
Baolong Wang et al.
Carcinogenesis, 41(6), 841-849 (2019-09-29)
Chloride intracellular channel protein 4 (CLIC4) has been implicated in different types of cancers, but the role of CLIC4 in the development of gastric cancer (GC) remains unknown. We analyzed the expression of CLIC4 in 102 pairs of gastric adenocarcinomas
Wei Guo et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 9049-9057 (2015-06-19)
A recent study reported that miR-570 was the most important microRNA in the microRNA gene networks of alcoholic liver disease that has the potential of progressing to hepatocellular carcinoma. However, litter is known regarding the expression and specific function of