Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HSPB1(3315)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jong-Rung Tsai et al.
PloS one, 9(3), e91331-e91331 (2014-03-13)
Heat-shock proteins (HSPs) are molecular chaperones that protect proteins from damage. HSP27 expression is associated with cancer transformation and invasion. Ginkgo biloba extract (EGb761), the most widely sold herbal supplement, has antiangiogenic effects and induces tumor apoptosis. Data regarding the
Soo-Yeon Hwang et al.
European journal of medicinal chemistry, 139, 892-900 (2017-09-05)
Heat Shock Protein 27 (HSP27) is a member of small heat shock proteins with a highly-conserved α-crystalline domain. It inhibits aggregation of damaged proteins through a complex structural systems of phosphorylation-dependent oligomerization and self-assembly. It has been demonstrated that HSP27
Eva Hadadi et al.
Scientific reports, 6, 39035-39035 (2016-12-16)
Monocytes play a central role in regulating inflammation in response to infection or injury, and during auto-inflammatory diseases. Human blood contains classical, intermediate and non-classical monocyte subsets that each express characteristic patterns of cell surface CD16 and CD14; each subset