Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CDC42(998)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Arjun P Athreya et al.
Oncotarget, 8(16), 27199-27215 (2017-04-21)
We demonstrate that model-based unsupervised learning can uniquely discriminate single-cell subpopulations by their gene expression distributions, which in turn allow us to identify specific genes for focused functional studies. This method was applied to MDA-MB-231 breast cancer cells treated with
Xiaolei Liu et al.
Development (Cambridge, England), 145(17) (2018-07-26)
Although major progress in our understanding of the genes and mechanisms that regulate lymphatic vasculature development has been made, we still do not know how lumen formation and maintenance occurs. Here, we identify the Ras-interacting protein Rasip1 as a key
Huanxin Ma et al.
Frontiers in oncology, 10, 438-438 (2020-05-01)
PIWI-interacting RNA (piRNA) is a kind of non-coding single stranded RNA which plays major roles in epigenetic expressions, genome rearrangement, and regulation of gene and protein. Because piRNAs are abnormally expressed in various cancers, they can be used as novel