Skip to Content
Merck

EHU117241

MISSION® esiRNA

targeting human CDC42

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGCAGGGCAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTCTGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAGACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTTACACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDC42(998)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Arjun P Athreya et al.
Oncotarget, 8(16), 27199-27215 (2017-04-21)
We demonstrate that model-based unsupervised learning can uniquely discriminate single-cell subpopulations by their gene expression distributions, which in turn allow us to identify specific genes for focused functional studies. This method was applied to MDA-MB-231 breast cancer cells treated with
Xiaolei Liu et al.
Development (Cambridge, England), 145(17) (2018-07-26)
Although major progress in our understanding of the genes and mechanisms that regulate lymphatic vasculature development has been made, we still do not know how lumen formation and maintenance occurs. Here, we identify the Ras-interacting protein Rasip1 as a key
Huanxin Ma et al.
Frontiers in oncology, 10, 438-438 (2020-05-01)
PIWI-interacting RNA (piRNA) is a kind of non-coding single stranded RNA which plays major roles in epigenetic expressions, genome rearrangement, and regulation of gene and protein. Because piRNAs are abnormally expressed in various cancers, they can be used as novel