Skip to Content
Merck

EHU121531

MISSION® esiRNA

targeting human TRIM8

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAGATCCGAAGGAATGAAATCCGGATGCTCATGAAGCAGCAGGACCGGCTGGAGGAGCGAGAGCAGGACATTGAGGACCAGCTGTACAAACTCGAGTCAGACAAGCGCCTGGTGGAGGAGAAAGTGAACCAACTGAAGGAGGAAGTTCGGCTGCAGTACGAGAAGCTGCACCAGCTGCTGGACGAGGACCTGCGGCAGACAGTGGAGGTCCTAGACAAGGCCCAGGCCAAGTTCTGCAGCGAGAACGCAGCGCAGGCGCTGCACCTCGGGGAGCGCATGCAGGAGGCCAAGAAGCTGCTGGGCTCCCTGCAGCTGCTCTTTGATAAGACGGAGGATGTCAGCTTCATGAAGAACACCAAGTCTGTGAAAATCCTGATGGACAGGACCCAGACCTGCACGAGCAGCAGCCTTTCCCCCACTAAGATCGGCCACCTGAACTCCAAGCTCTTCCTGAACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRIM8(81603)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Litao Guo et al.
Inflammation, 40(2), 454-463 (2016-12-21)
Pseudomonas aeruginosa (PA)-induced keratitis is a rapidly progressive ocular infectious disease that often leads to inflammatory epithelial edema, stromal infiltration, tissue destruction, corneal ulceration, and vision loss. In this study, we investigate the role of tripartite motif 8 (TRIM8) in
Xiaoyan Dang et al.
Cell transplantation, 29, 963689720949247-963689720949247 (2020-08-26)
Tripartite motif 8 (TRIM8) is a member of the TRIM protein family that has been found to be implicated in cardiovascular disease. However, the role of TRIM8 in myocardial ischemia/reperfusion (I/R) has not been investigated. We aimed to explore the
Xue Bai et al.
Experimental cell research, 388(2), 111818-111818 (2020-01-10)
Stroke is a leading global cause of mortality and disability. However, the pathogenesis that contributes to stroke has not been fully understood. The tripartite motif (TRIM)-containing proteins usually exhibit essential regulatory roles during various biological processes. TRIM8 is a RING