Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGAGATCCGAAGGAATGAAATCCGGATGCTCATGAAGCAGCAGGACCGGCTGGAGGAGCGAGAGCAGGACATTGAGGACCAGCTGTACAAACTCGAGTCAGACAAGCGCCTGGTGGAGGAGAAAGTGAACCAACTGAAGGAGGAAGTTCGGCTGCAGTACGAGAAGCTGCACCAGCTGCTGGACGAGGACCTGCGGCAGACAGTGGAGGTCCTAGACAAGGCCCAGGCCAAGTTCTGCAGCGAGAACGCAGCGCAGGCGCTGCACCTCGGGGAGCGCATGCAGGAGGCCAAGAAGCTGCTGGGCTCCCTGCAGCTGCTCTTTGATAAGACGGAGGATGTCAGCTTCATGAAGAACACCAAGTCTGTGAAAATCCTGATGGACAGGACCCAGACCTGCACGAGCAGCAGCCTTTCCCCCACTAAGATCGGCCACCTGAACTCCAAGCTCTTCCTGAACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRIM8(81603)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Litao Guo et al.
Inflammation, 40(2), 454-463 (2016-12-21)
Pseudomonas aeruginosa (PA)-induced keratitis is a rapidly progressive ocular infectious disease that often leads to inflammatory epithelial edema, stromal infiltration, tissue destruction, corneal ulceration, and vision loss. In this study, we investigate the role of tripartite motif 8 (TRIM8) in
Xiaoyan Dang et al.
Cell transplantation, 29, 963689720949247-963689720949247 (2020-08-26)
Tripartite motif 8 (TRIM8) is a member of the TRIM protein family that has been found to be implicated in cardiovascular disease. However, the role of TRIM8 in myocardial ischemia/reperfusion (I/R) has not been investigated. We aimed to explore the
Xue Bai et al.
Experimental cell research, 388(2), 111818-111818 (2020-01-10)
Stroke is a leading global cause of mortality and disability. However, the pathogenesis that contributes to stroke has not been fully understood. The tripartite motif (TRIM)-containing proteins usually exhibit essential regulatory roles during various biological processes. TRIM8 is a RING