Skip to Content
Merck

EHU121861

MISSION® esiRNA

targeting human TAF8

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCAAAACGGTCTCAGAGGATGGTCATCACTGCTCCTCCGGTGACCAATCAGCCAGTGACCCCCAAGGCCCTCACTGCAGGGCAGAACCGACCCCACCCGCCGCACATCCCCAGCCATTTTCCTGAGTTCCCTGATCCCCACACCTACATCAAAACTCCGACGTACCGTGAGCCCGTGTCAGACTACCAGGTCCTGCGGGAGAAGGCTGCATCCCAGAGGCGCGATGTGGAGCGGGCACTTACCCGTTTCATGGCCAAGACAGGCGAGACTCAGAGTCTTTTCAAAGATGACGTCAGCACATTTCCATTGATTGCTGCCAGACCTTTCACCATCCCCTACCTGACAGCTCTTCTTCCGTCTGAACTGGAGATGCAACAAATGGAACAGATTCCTCGGAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TAF8(129685)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



E Marques et al.
Oncogene, 35(11), 1386-1398 (2015-06-16)
Differentiated epithelial structure communicates with individual constituent epithelial cells to suppress their proliferation activity. However, the pathways linking epithelial structure to cessation of the cell proliferation machinery or to unscheduled proliferation in the context of tumorigenesis are not well defined.
Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we