Skip to Content
Merck

EHU122491

MISSION® esiRNA

targeting human FABP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTTCTCCGGCAAGTACCAACTGCAGAGCCAGGAAAACTTTGAAGCCTTCATGAAGGCAATCGGTCTGCCGGAAGAGCTCATCCAGAAGGGGAAGGATATCAAGGGGGTGTCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTCACCATCACCGCTGGGTCCAAAGTGATCCAAAACGAATTCACGGTGGGGGAGGAATGTGAGCTGGAGACAATGACAGGGGAGAAAGTCAAGACAGTGGTTCAGTTGGAAGGTGACAATAAACTGGTGACAACTTTCAAAAACATCAAGTCTGTGACCGAACTCAACGGCGACATAATCACCAATACCATGACATTGGGTGACATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FABP1(2168)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yujuan Wang et al.
PloS one, 14(4), e0214144-e0214144 (2019-04-23)
Castration is an important means of improving the beef quality via increasing fat deposition. However, little is known about the molecular mechanism underlying the fat deposition after castration. Here, the intramuscular fat (IMF) content of the steer group was shown
Yufei Chen et al.
Journal of pharmacy & pharmaceutical sciences : a publication of the Canadian Society for Pharmaceutical Sciences, Societe canadienne des sciences pharmaceutiques, 20(0), 239-251 (2017-08-16)
To investigate the effect of clofibrate on inducing liver fatty acid binding protein (FABP1) following a high-fat load in a hepatocyte cell culture model. Rat hepatoma cells (CRL-1548) were treated with a fatty acid (FA) mixture consisting of oleate:palmitate (2:1)
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death