Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGTCACCTCTGACCCTCGAAGATTTCAAGTTCCTGGCGGTGCTGGGCCGGGGTCATTTTGGGAAGGTGCTCCTCTCCGAATTCCGGCCCAGTGGGGAGCTGTTCGCCATCAAGGCTCTGAAGAAAGGGGACATTGTGGCCCGAGACGAGGTGGAGAGCCTGATGTGTGAGAAGCGGATATTGGCGGCAGTGACCAGTGCGGGACACCCCTTCCTGGTGAACCTCTTCGGCTGTTTCCAGACACCGGAGCACGTGTGCTTCGTGATGGAGTACTCGGCCGGTGGGGACCTGATGCTGCACATCCACAGCGACGTGTTCTCTGAGCCCCGTGCCATCTTTTATTCCGCCTGCGTGGTGCTGGGCCTACAGTTTCTTCACGAACACAAGATCGTCTACAGGGACCTGAAGTTGGACAATTTGCTCCTGGACACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PKN1(5585)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guiling Wang et al.
Oncotarget, 6(12), 9877-9886 (2015-04-19)
To date, microrchidia (MORC) family CW-type zinc-finger 2 (MORC2), has been found to be involved in p21-activated kinase1 (PAK1) pathway to maintain genomic integrity. Here, we explore its novel role in cancer. We demonstrate that PAK1-mediated MORC2 phosphorylation promotes cell
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell