Skip to Content
Merck

EHU138031

MISSION® esiRNA

targeting human ICAM1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGAACCTATCCCGGGACAGGGCCTCTTCCTCGGCCTTCCCATATTGGTGGCAGTGGTGCCACACTGAACAGAGTGGAAGACATATGCCATGCAGCTACACCTACCGGCCCTGGGACGCCGGAGGACAGGGCATTGTCCTCAGTCAGATACAACAGCATTTGGGGCCATGGTACCTGCACACCTAAAACACTAGGCCACGCATCTGATCTGTAGTCACATGACTAAGCCAAGAGGAAGGAGCAAGACTCAAGACATGATTGATGGATGTTAAAGTCTAGCCTGATGAGAGGGGAAGTGGTGGGGGAGACATAGCCCCACCATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ICAM1(3383)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Haifeng Ma et al.
Journal of cardiovascular pharmacology, 76(5), 617-626 (2020-11-10)
Emerging evidence has demonstrated that long noncoding RNAs are related to the pathogenesis of atherosclerosis. We aimed to investigate the roles and molecular mechanisms of myocardial infarction-associated transcript (MIAT) in the proliferation, migration, and invasion of oxidized low-density lipoprotein (ox-LDL)-induced
Sheng-Wei Lai et al.
Nutrients, 11(6) (2019-06-19)
Natural products have historically been regarded as an important resource of therapeutic agents. Resveratrol and melatonin have been shown to increase SIRT1 activity and stimulate deacetylation. Glioblastoma multiforme (GBM) is the deadliest of malignant types of tumor in the central
Dejun Xu et al.
Biological chemistry, 401(5), 601-615 (2019-12-22)
Long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been identified as a regulatory molecule in angiogenesis. The goal of this study was to illustrate how MEG3 affects the angiogenesis of vascular endothelial cells. Expression of MEG3, miR-147 and