Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCGAGTGTTTGGCCACAGTTCGGGACCTATGGTAGAAAAATACTCAGTAGCTACCCAGATTGTAATGGGTGGCGTTACTGGCTGGTGTGCAGGATTTCTGTTCCAGAAAGTTGGAAAACTTGCAGCAACTGCAGTAGGTGGTGGCTTTCTTCTTCTTCAGATTGCTAGTCATAGTGGCTATGTGCAGATTGACTGGAAGAGAGTTGAAAAAGATGTAAATAAAGCAAAAAGACAGATTAAGAAACGAGCGAACAAAGCAGCACCTGAAATCAACAATTTAATTGAAGAAGCAACAGAATTTATCAAGCAGAACATTGTGATATCCAGTGGATTTGTGGGAGGCTTTTTGCTCGGACTTGCATCTTAAGGACATGAATATTCTCCCATAACGGATTCAACTATGAGAAGAGAAGTGGCAGCAATAAGGCAGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FUNDC1(139341)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
L Hui et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(5), 596-606 (2018-10-05)
The purpose of our study was to investigate an underlying mechanism that hydrogen peroxide-induced mitophagy contributed to laryngeal cancer cells survivals under oxidative stress condition. Tumor tissue and serum samples were collected from patients with laryngeal cancer. The Hep2 cell
Hao Zhou et al.
Basic research in cardiology, 113(4), 23-23 (2018-05-11)
Mitochondrial fission and mitophagy are considered key processes involved in the pathogenesis of cardiac microvascular ischemia reperfusion (IR) injury although the upstream regulatory mechanism for fission and mitophagy still remains unclear. Herein, we reported that NR4A1 was significantly upregulated following