Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATAGTGAGTGTGGGCGATCCTAAGAAGAAATATACACGGTTTGAGAAGATTGGACAAGGTGCTTCAGGCACCGTGTACACAGCAATGGATGTGGCCACAGGACAGGAGGTGGCCATTAAGCAGATGAATCTTCAGCAGCAGCCCAAGAAAGAGCTGATTATTAATGAGATCCTGGTCATGAGGGAAAACAAGAACCCAAACATTGTGAATTACTTGGACAGTTACCTCGTGGGAGATGAGCTGTGGGTTGTTATGGAATACTTGGCTGGAGGCTCCTTGACAGATGTGGTGACAGAAACTTGCATGGATGAAGGCCAAATTGCAGCTGTGTGCCGTGAGTGTCTGCAGGCTCTGGAGTTCTTGCATTCGAACCAGGTCATTCACAGAGACATCAAGAGTGACAATATTCTGTTGGGAATGGATGGCTCTGTCAAGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PAK1(5058)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guiling Wang et al.
Oncotarget, 6(12), 9877-9886 (2015-04-19)
To date, microrchidia (MORC) family CW-type zinc-finger 2 (MORC2), has been found to be involved in p21-activated kinase1 (PAK1) pathway to maintain genomic integrity. Here, we explore its novel role in cancer. We demonstrate that PAK1-mediated MORC2 phosphorylation promotes cell
Nikhlesh K Singh et al.
The Journal of biological chemistry, 292(34), 14080-14091 (2017-06-29)
Although the involvement of Rho proteins in the pathogenesis of vascular diseases is well studied, little is known about the role of their upstream regulators, the Rho guanine nucleotide exchange factors (RhoGEFs). Here, we sought to identify the RhoGEFs involved
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)