Skip to Content
Merck

EHU143271

MISSION® esiRNA

targeting human ILK

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ILK(3611)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Qiaomei Zheng et al.
Drug design, development and therapy, 14, 3663-3672 (2020-09-29)
To explore the exact mechanism through which emodin down-regulates the migration and invasion abilities of endometrial stromal cells. Moreover, to explore the theoretical basis of emodin in the treatment of endometriosis. Endometriosis endometrial stromal cells (EESs) were cultured from 15
Qiaomei Zheng et al.
Reproductive sciences (Thousand Oaks, Calif.), 23(11), 1526-1535 (2016-05-01)
To determine whether emodin facilitates the mesenchymal-epithelial transition (MET) of endometrial stromal cells (ESCs) as well as to explore the mechanism through which emodin favored the MET of ESCs. Cell viability was tested by methyl thiazolyl tetrazolium assay. Cell migration
Xiu-Mei Yang et al.
Investigative ophthalmology & visual science, 59(5), 1779-1789 (2018-04-04)
Vasculogenesis has been shown to contribute to the formation of choroidal neovascularization (CNV). However, the mechanism behind the recruitment of endothelial progenitor cells (EPC) to CNV is not well understood. Therefore, we were interested to know whether integrin-linked kinase (ILK)