Skip to Content
Merck

EHU147311

MISSION® esiRNA

targeting human CORO1A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCACCCAGACACGATCTACAGTGTGGACTGGAGCCGAGATGGAGGCCTCATTTGTACCTCCTGCCGTGACAAGCGCGTGCGCATCATCGAGCCCCGCAAAGGCACTGTCGTAGCTGAGAAGGACCGTCCCCACGAGGGGACCCGGCCCGTGCGTGCAGTGTTCGTGTCGGAGGGGAAGATCCTGACCACGGGCTTCAGCCGCATGAGTGAGCGGCAGGTGGCGCTGTGGGACACAAAGCACCTGGAGGAGCCGCTGTCCCTGCAGGAGCTGGACACCAGCAGCGGTGTCCTGCTGCCCTTCTTTGACCCTGACACCAACATCGTCTACCTCTGTGGCAAGGGTGACAGCTCAATCCGGTACTTTGAGATCACTTCCGAGGCCCCTTTCCTGCACTATCTCTCCATGTTCAGTTCCAAGGAGTCCCAGCGGGGCATGGGCTACATGCCCAAACGTGGCCTGGAGGTGAACAAGTGTGAGATCGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CORO1A(11151)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Carole Henique et al.
Nature communications, 8(1), 1829-1829 (2017-12-01)
Crescentic rapidly progressive glomerulonephritis (RPGN) represents the most aggressive form of acquired glomerular disease. While most therapeutic approaches involve potentially toxic immunosuppressive strategies, the pathophysiology remains incompletely understood. Podocytes are glomerular epithelial cells that are normally growth-arrested because of the
Matthew Van De Pette et al.
PLoS genetics, 12(3), e1005916-e1005916 (2016-03-11)
The accurate diagnosis and clinical management of the growth restriction disorder Silver Russell Syndrome (SRS) has confounded researchers and clinicians for many years due to the myriad of genetic and epigenetic alterations reported in these patients and the lack of
Hui Guo et al.
BMC gastroenterology, 15, 104-104 (2015-08-15)
Our previous research suggested that p57 downregulation could accelerate the growth and invasion of hepatocellular carcinoma in vitro and in vivo. To evaluate the role of cytoplasmic p57 and its regulatory mechanism during hepatocellular carcinoma invasion. We examined the subcellular