Skip to Content
Merck

EHU158451

MISSION® esiRNA

targeting human DNMT3B

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCGACAGCTCTCCAATACTCAGGTTAATGCTGAAAAATCATCCAAGACAGTTATTGCAAGAGTTTAATTTTTGAAAACTGGCTACTGCTCTGTGTTTACAGACGTGTGCAGTTGTAGGCATGTAGCTACAGGACATTTTTAAGGGCCCAGGATCGTTTTTTCCCAGGGCAAGCAGAAGAGAAAATGTTGTATATGTCTTTTACCCGGCACATTCCCCTTGCCTAAATACAAGGGCTGGAGTCTGCACGGGACCTATTAGAGTATTTTCCACAATGATGATGATTTCAGCAGGGATGACGTCATCATCACATTCAGGGCTATTTTTTCCCCCACAAACCCAAGGGCAGGGGCCACTCTTAGCTAAATCCCTCCCCGTGACTGCAATAGAACCCTCTGGGGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DNMT3B(1789)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Chelsea R McCoy et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 39(16), 3144-3158 (2019-01-27)
There is growing evidence of abnormal epigenetic processes playing a role in the neurobiology of psychiatric disorders, although the precise nature of these anomalies remains largely unknown. To study neurobiological (including epigenetic) factors that influence emotionality, we use rats bred
Yue Zhou et al.
American journal of translational research, 11(3), 1736-1747 (2019-04-12)
Temporomandibular joint (TMJ) arthritis causes severe debilitation and has few treatment options. Here, we found a small molecule, DNA methyltransferase 3B (Dnmt3b), as a putative therapeutic target, partially rescued osteoarthritic phenotype. Dnmt3b was detected differentially expressed in cell zones of
Hiroaki Fujimori et al.
Scientific reports, 5, 18231-18231 (2015-12-17)
A comprehensive genome-wide screen of radiosensitization targets in HeLa cells was performed using a shRNA-library/functional cluster analysis and DNMT3B was identified as a candidate target. DNMT3B RNAi increased the sensitivity of HeLa, A549 and HCT116 cells to both γ-irradiation and