Skip to Content
Merck

EMU015011

MISSION® esiRNA

targeting mouse Akt1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACGATGGCACCTTTATTGGCTACAAGGAACGGCCTCAGGATGTGGATCAGCGAGAGTCCCCACTCAACAACTTCTCAGTGGCACAATGCCAGCTGATGAAGACAGAGCGGCCAAGGCCCAACACCTTTATCATCCGCTGCCTGCAGTGGACCACAGTCATTGAGCGCACCTTCCATGTGGAAACGCCTGAGGAGCGGGAAGAATGGGCCACCGCCATTCAGACTGTGGCCGATGGACTCAAGAGGCAGGAAGAAGAGACGATGGACTTCCGATCAGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGTGTGACCATGAACGAGTTTGAGTACCTGAAACTACTGGGCAAGGGCACCTTTGGGAAAGTGATTCTGGTGAAAGAGAAGGCCACAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Tsung-Chieh Lin et al.
The Journal of pathology, 237(1), 50-61 (2015-05-01)
Ghrelin is an appetite-regulating molecule that promotes growth hormone (GH) release and food intake through growth hormone secretagogue receptor (GHS-R). Recently, high ghrelin levels have been detected in various types of human cancer. Ghrelin expression is observed in proximal and
Toni M Brand et al.
Cancer research, 74(18), 5152-5164 (2014-08-20)
The EGFR antibody cetuximab is used to treat numerous cancers, but intrinsic and acquired resistance to this agent is a common clinical outcome. In this study, we show that overexpression of the oncogenic receptor tyrosine kinase AXL is sufficient to
Lucía Barbier-Torres et al.
Oncotarget, 6(4), 2509-2523 (2015-02-05)
The current view of cancer progression highlights that cancer cells must undergo through a post-translational regulation and metabolic reprogramming to progress in an unfriendly environment. In here, the importance of neddylation modification in liver cancer was investigated. We found that