Skip to Content
Merck

EMU016691

MISSION® esiRNA

targeting mouse Fis1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGACTGTGGCCCAGTAGAGACCTTAGTGTGAGGCTTTCAGGGGCGGCGGCCATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGATCTGAAGAATTTTGAAAGGAAATTTCAGTCTGAGCAGGCAGCTGGTTCTGTGTCCAAGAGCACGCAATTTGAATATGCCTGGTGCCTGGTTCGAAGCAAATACAATGAGGACATCCGCAGAGGCATCGTGCTGCTGGAGGAGCTGTTGCCCAAAGGGAGCAAAGAGGAACAGCGGGACTATGTCTTCTACCTGGCCGTGGGCAACTACCGGCTCAAGGAATATGAAAAGGCTCTAAAGTATGTGCGAGGGCTGTTGCAGACTGAGCCCCAGAACAACCAGGCCAAGGAGCTGGAACGCCTGATTGATAAGGCCATGAAGAAAGATGGACTGGTAGGCATGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Qinfang Shen et al.
Molecular biology of the cell, 25(1), 145-159 (2013-11-08)
Mitochondrial fission is mediated by the dynamin-related protein Drp1 in metazoans. Drp1 is recruited from the cytosol to mitochondria by the mitochondrial outer membrane protein Mff. A second mitochondrial outer membrane protein, named Fis1, was previously proposed as recruitment factor
Jichi Zhou et al.
Cell stress & chaperones, 24(2), 369-383 (2019-01-19)
Sirtuin 3 (Sirt3)-modified mitochondrial fission participates in the progression of several types of cancers. However, its role in tongue cancer requires investigation. The aim of our study is to determine whether Sirt3 knockdown regulates the viability of tongue cancer cells
Mitsuo Kato et al.
Communications biology, 4(1), 30-30 (2021-01-06)
Diabetic kidney disease (DKD) is a major complication of diabetes. Expression of members of the microRNA (miRNA) miR-379 cluster is increased in DKD. miR-379, the most upstream 5'-miRNA in the cluster, functions in endoplasmic reticulum (ER) stress by targeting EDEM3.