Skip to Content
Merck

EMU033001

MISSION® esiRNA

targeting mouse Gja3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTTCGAAGTGGGGTTCATCGCGGGCCAGTACTTTCTATACGGCTTCCAGCTGCAGCCACTTTACCGCTGCGACCGCTGGCCCTGCCCCAACACTGTGGACTGTTTCATCTCCAGGCCCACAGAGAAGACCATCTTTGTCATCTTCATGCTGGCTGTGGCCTGTGCGTCACTGGTACTCAACATGCTGGAGATTTACCACCTGGGCTGGAAGAAGCTCAAGCAGGGAGTTACTAACCACTTCAACCCAGATGCCTCAGAAGCCAGGCACAAGCCCTTGGACCCCCTACCCACGGCCACCAGCTCTGGCCCGCCCAGCGTCTCCATCGGGTTCCCACCTTATTACACACACCCTGCCTGTCCCACAGTACAGGCAAAGGCCATAGGGTTTCCTGGGGCCCCACTATCACCAGCAGACTTCACAGTGGTGACTCTAAACGATGCTCAAGGCAGAAACCACCCAGTCAAACACTGCAATGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Dominique Thuringer et al.
Oncotarget, 6(12), 10267-10283 (2015-04-15)
High levels of circulating heat shock protein 70 (HSP70) are detected in many cancers. In order to explore the effects of extracellular HSP70 on human microvascular endothelial cells (HMEC), we initially used gap-FRAP technique. Extracellular human HSP70 (rhHSP70), but not
Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Tobias Forster et al.
Oncotarget, 5(6), 1621-1634 (2014-04-20)
The extreme aggressiveness of pancreatic ductal adenocarcinoma (PDA) has been associated with blocked gap junctional intercellular communication (GJIC) and the presence of cancer stem cells (CSCs). We examined whether disturbed GJIC is responsible for a CSC phenotype in established and