Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAACCCACTCGGATGTGAAGAGATACCAGTGCCAGGCCTGTGCCCGAACCTTCTCCCGCATGTCCTTGCTCCACAAGCACCAAGAGTCTGGCTGCTCCGGAGGCCCTCGCTGACCCTGCTACCTCCCCATCCTCGCTGGCATCTTCCCGGAGCTCACCCTCCTCCTCACTGCCAGGACTCCTTCCAGCCTTGGTCCGGGGACCTGTGGCGTCCATGTCTGGACCTGGTTCCTGCTTGGCTCTCTTGGTGGCCTTTGCCGCAGGTGGCTGATGGAGTGCCTTTGTACCCGCCCAGAGCCTCCTACCCCTCAGTATTCATGAGGTGTAGCCTCTGGACACAGCTGCTTCGAGCCATAGAACTAAAGCCAACCCACTGGCTGGGAAGCTTGAACCCCGCTCAGGGGACCCCACTTCCCTACCTCCCTCAAGG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SNAI1(20613), Snai1(20613)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wai-Kin So et al.
FEBS letters, 588(21), 3998-4007 (2014-09-28)
Aberrant epidermal growth factor receptor (EGFR) activation is associated with ovarian cancer progression. In this study, we report that the EGFR ligand amphiregulin (AREG) stimulates cell invasion and down-regulates E-cadherin expression in two human ovarian cancer cell lines, SKOV3 and
Qingsheng Dong et al.
PloS one, 9(6), e98651-e98651 (2014-06-25)
Glioblastoma is an extraordinarily aggressive disease that requires more effective therapeutic options. Snail family zinc finger 1, dysregulated in many neoplasms, has been reported to be involved in gliomas. However, the biological mechanisms underlying SNAI1 function in gliomas need further
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular