Skip to Content
Merck

EMU059761

MISSION® esiRNA

targeting mouse Gsk3b

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGGCCACAGGAAGTCAGTTATACAGACACGAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCTGGAGAACTGGTTGCCATCAAGAAAGTTCTACAGGACAAGCGATTTAAGAACCGAGAGCTCCAGATCATGAGAAAGCTAGACCACTGTAACATAGTCCGACTGCGGTATTTCTTCTACTCGAGTGGCGAGAAGAAAGATGAGGTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAGACAGTGTACAGAGTCGCCAGACACTATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTGTATATGTATCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGAATCTGCCATCGAGACAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yunfeng Fu et al.
OncoTargets and therapy, 7, 1159-1168 (2014-07-17)
Glycogen synthase kinase-3 (GSK-3) plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/β(Tyr279/216) in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition
Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
I Azoulay-Alfaguter et al.
Oncogene, 34(35), 4613-4623 (2014-12-17)
There is controversy over the role of glycogen synthase kinase-3 (GSK-3) in cancer progression. Recent work has implicated GSK-3 in the regulation of mammalian target of rapamycin (mTOR), a known player in malignant transformation. Autophagy, a self-degradation pathway, is inhibited