Skip to Content
Merck

EMU079161

MISSION® esiRNA

targeting mouse Tlr8

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTTCCAGCACTTCCCTCAGGACGATTCCTTCTACCTGGTTTGAAAATCTGTCAAATCTGAAGGAACTCCATCTTGAATTCAACTATTTAGTTCAAGAAATTGCCTCGGGGGCATTTTTAACAAAACTACCCAGTTTACAAATCCTTGATTTGTCCTTCAACTTTCAATATAAGGAATATTTACAATTTATTAATATTTCCTCAAATTTCTCTAAGCTTCGTTCTCTCAAGAAGTTGCACTTAAGAGGCTATGTGTTCCGAGAACTTAAAAAGAAGCATTTCGAGCATCTCCAGAGTCTTCCAAACTTGGCAACCATCAACTTGGGCATTAACTTTATTGAGAAAATTGATTTCAAAGCTTTCCAGAATTTTTCCAAACTCGACGTTATCTATTTATCAGGAAATCGCATAGCATCTGTATTAGATGGTACAGATTATTCCTCTTGGCGAAATCGTCTTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Mark A Bernard et al.
PloS one, 9(8), e104039-e104039 (2014-08-05)
Even though combined anti-retroviral therapy (cART) dramatically improves patient survival, they remain at a higher risk of being afflicted with non-infectious complications such as cardiovascular disease (CVD). This increased risk is linked to persistent inflammation and chronic immune activation. In
Noriko Ishii et al.
Journal of immunology (Baltimore, Md. : 1950), 193(10), 5118-5128 (2014-10-10)
Nucleic acid-sensing TLRs are involved in both antimicrobial immune responses and autoimmune inflammation. TLR8 is phylogenetically and structurally related to TLR7 and TLR9, which undergo proteolytic processing in the endolysosomes to generate functional receptors. Recent structural analyses of human TLR8
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing