Skip to Content
Merck

EMU084951

MISSION® esiRNA

targeting mouse Ptpn6

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGAATCGGGTCTTGGAACTGAACAAGAAGCAGGAGTCGGAGGACACACGCAAGGCTGGCTTCTGGGAGGAGTTTGAGAGTCTACAAAAGCAGGAGGTAAAGAATCTACACCAACGTCTGGAAGGGCAGCGGCCAGAGAACAAGAGCAAGAACCGCTACAAGAACATTCTTCCCTTTGACCACAGCCGAGTGATCCTGCAGGGACGTGACAGTAACATCCCAGGCTCTGACTACATCAATGCCAACTACGTGAAGAACCAGCTGCTAGGTCCAGATGAGAACTCTAAGACCTACATCGCCAGCCAGGGCTGTCTGGATGCCACAGTCAATGACTTCTGGCAGATGGCTTGGCAGGAGAACACTCGTGTCATCGTCATGACTACCAGAGAGGTGGAGAAAGGCCGGAACAAATGTGTCCCATACTGGCCCGAGGTGGGCACTCAGCGTGTCTATGGTCTCTACTCTGTGACCAACAGTAGGGAGCATGACACAGCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Jieqiong Wang et al.
Breast cancer research and treatment, 148(2), 279-289 (2014-10-11)
Signal transducer and activator of transcription 3 (STAT3) is implicated breast cancer metastasis and represents a potential target for developing new anti-tumor metastasis drugs. The purpose of this study is to investigate whether the natural agent 1'-acetoxychavicol acetate (ACA), derived
Tiantian Sun et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(17), 4689-4704 (2014-07-06)
The role and clinical implication of the transmembrane protein with EGF and two follistatin motifs 2 (TMEFF2) in gastric cancer is poorly understood. Gene expression profile analyses were performed and Gene Set Enrichment Analysis (GSEA) was used to explore its
Ji Hoon Jung et al.
British journal of pharmacology, 172(14), 3565-3578 (2015-04-01)
Epigallocatechin-3-gallate (EGCG) is a component of green tea known to have chemo-preventative effects on several cancers. However, EGCG has limited clinical application, which necessitates the development of a more effective EGCG prodrug as an anticancer agent. Derivatives of EGCG were