Skip to Content
Merck

EHU023131

MISSION® esiRNA

targeting human LAMC2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCAGCTGTCCAGCTTGCTATAATCAAGTGAAGATTCAGATGGATCAGTTTATGCAGCAGCTTCAGAGAATGGAGGCCCTGATTTCAAAGGCTCAGGGTGGTGATGGAGTAGTACCTGATACAGAGCTGGAAGGCAGGATGCAGCAGGCTGAGCAGGCCCTTCAGGACATTCTGAGAGATGCCCAGATTTCAGAAGGTGCTAGCAGATCCCTTGGTCTCCAGTTGGCCAAGGTGAGGAGCCAAGAGAACAGCTACCAGAGCCGCCTGGATGACCTCAAGATGACTGTGGAAAGAGTTCGGGCTCTGGGAAGTCAGTACCAGAACCGAGTTCGGGATACTCACAGGCTCATCACTCAGATGCAGCTGAGCCTGGCAGAAAGTGAAGCTTCCTTGGGAAACACTAACATTCCTGCCTCAGACCACTACGTGGGGCCAAATGGCTTTAAAAGTCTGGCTCAGGAGGCCACAAGATTAGCAGAAAGCCACGTTGAGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LAMC2(3918)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yao-Fei Pei et al.
The American journal of pathology, 189(8), 1637-1653 (2019-07-28)
Cholangiocarcinoma (CCA) is a malignant cancer that is associated with high mortality rates. The relationship between laminin γ 2 chain gene (LAMC2) and epidermal growth factor receptor (EGFR) has been previously documented in gastric cancer and oral squamous cell carcinoma.
Qiang-Hua Zhou et al.
Cancer management and research, 10, 2983-2995 (2018-09-15)
Molecular biomarkers, especially serologic factors, have been widely applied in cancer diagnosis and patient follow-up. However, there are few valuable prognostic factors in penile squamous cell carcinoma (PSCC). Here, the authors investigated whether laminin gamma 2 (LAMC2) expression, especially serum
Yan Liang et al.
Cell death and differentiation, 25(11), 1980-1995 (2018-03-08)
Esophageal squamous cell carcinoma (ESCC) is the main subtype of esophageal cancer. Long noncoding RNAs (lncRNAs) are thought to play a critical role in cancer development. Recently, lncRNA CASC9 was shown to be dysregulated in many cancer types, but the