Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGAGGCAGGTGGCCCGAGGACGCTCCCTGCTCCACGTCTGCGCCGCCGCCGGAGTCCACTCCCAGTGCTTGCAAGATTCCAAGTTCTCACCTCTTAAAGAAAACCCACCCCGTAGATTCCCATCATACACTTCCTTCTTTTTTAAAAAAGTTGGGTTTTCTCCATTCAGGATTCTGTTCCTTAGGTTTTTTTCCTTCTGAAGTGTTTCACGAGAGCCCGGGAGCTGCTGCCCTGCGGCCCCGTCTGTGGCTTTCAGCCTCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BSG(682)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Junchen Chen et al.
PloS one, 12(8), e0183689-e0183689 (2017-08-24)
Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play
Qi-Ming Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2308-2319 (2016-11-11)
It is well documented that overexpression of EMMPRIN (extracellular matrix metalloproteinase inducer) and MMPs (matrix metalloproteinases) by monocytes/macrophages plays an important role in atherosclerotic plaque rupture. Green tea polyphenol epigallocatechin-3-gallate (EGCG) has a variety of pharmacological properties and exerts cardiovascular
Adam L Vanarsdall et al.
mBio, 9(3) (2018-05-10)
Human cytomegalovirus (HCMV) replicates in many diverse cell types in vivo, and entry into different cells involves distinct entry mechanisms and different envelope glycoproteins. HCMV glycoprotein gB is thought to act as the virus fusogen, apparently after being triggered by