Skip to Content
Merck

EHU092331

MISSION® esiRNA

targeting human VAMP7 (1)

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTGTGAAACTTGAAAGAGAATAGACAGTATGACATATAGAATTAATACAAAACAGTTTAACAACCATTTAACTGCAGTGTAAGAAAATTGGACTGTAATCATATCGCTACTGGCATCTGTTATCTAGTATGCATTTCTGGTGTGTATCTGAAAGGAAGACATTTTCTACCCTAGATCCAATTGCATTTATTTATCAATAAGTGCCATTAAATTGAAATTATATTACATTTTACACTTTCTCAATGAATGAACAAATTAGTCTGTAGAATCTAGCCACCTGTTTAGCCTAGTCATGTGCCTTGAACATATATGTGTCCCATAATCTGGCTCATGGTACCTGTTCTTCTATCCAAACCTTTCAATTCATGCTACCTGATTCATTTATTTGACATAGATCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VAMP7(6845)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Praneeth Chitirala et al.
Frontiers in immunology, 10, 1855-1855 (2019-08-27)
Cytotoxic T lymphocytes kill infected or malignant cells through the directed release of cytotoxic substances at the site of target cell contact, the immunological synapse. While genetic association studies of genes predisposing to early-onset life-threatening hemophagocytic lymphohistiocytosis has identified components
Juan José Saez et al.
Cells, 10(2) (2021-02-13)
LAT is an important player of the signaling cascade induced by TCR activation. This adapter molecule is present at the plasma membrane of T lymphocytes and more abundantly in intracellular compartments. Upon T cell activation the intracellular pool of LAT
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.