Skip to Content
Merck

EHU136041

MISSION® esiRNA

targeting human FZD2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human FZD2

storage temp.

−20°C

Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCTCAAGGTGCCATCCTATCTCAGCTACAAGTTTCTGGGCGAGCGTGATTGTGCTGCGCCCTGCGAACCTGCGCGGCCCGATGGTTCCATGTTCTTCTCACAGGAGGAGACGCGTTTCGCGCGCCTCTGGATCCTCACCTGGTCGGTGCTGTGCTGCGCTTCCACCTTCTTCACTGTCACCACGTACTTGGTAGACATGCAGCGCTTCCGCTACCCAGAGCGGCCTATCATTTTTCTGTCGGGCTGCTACACCATGGTGTCGGTGGCCTACATCGCGGGCTTCGTGCTCCAGGAGCGCGTGGTGTGCAACGAGCGCTTCTCCGAGGACGGTTACCGCACGGTGGTGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATGCTCTACTTCTTCAGCATGGCCAGCTCCATCTGGTGGGTCATCCTGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiang Hu et al.
The Turkish journal of gastroenterology : the official journal of Turkish Society of Gastroenterology, 31(2), 167-179 (2020-03-07)
Autophagy plays a positive role in the prevention of liver damage after hepatic ischemia-reperfusion injury (HIRI); however, the molecular mechanism is still a mystery. Understanding the molecular events behind this injury may have important implications for devising proper strategies for
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that
Norihiro Chatani et al.
Liver international : official journal of the International Association for the Study of the Liver, 35(8), 2017-2026 (2014-12-10)
Obesity-related adipocytokine dysregulation is known to accelerate liver fibrosis progression. Recently, a natural Wnt5a inhibitor, secreted frizzled-related protein 5 (Sfrp5), was identified as a novel adipocytokine that has reduced expression in obese adipose tissue in both rodents and human. In

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service