Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATTGGCAGCCGCTGTAGAAGCTATGACAGAATACAAGCTTGTGGTGGTGGGCGCTGGAGGCGTGGGAAAGAGTGCCCTGACCATCCAGCTGATCCAGAACCACTTTGTGGACGAGTATGATCCCACTATAGAGGACTCCTACCGGAAACAGGTGGTCATTGATGGGGAGACATGTCTACTGGACATCTTAGACACAGCAGGTCAAGAAGAGTATAGTGCCATGCGGGACCAGTACATGCGCACAGGGGAGGGCTTCCTCTGTGTATTTGCCATCAACAACACCAAGTCCTTCGAGGACATCCATCAGTACA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... HRAS1(15461), Hras1(15461)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jagadish Loganathan et al.
International journal of oncology, 44(6), 2009-2015 (2014-04-11)
Breast cancer metastasis is one of the major reasons for the high morbidity and mortality of breast cancer patients. In spite of surgical interventions, chemotherapy, radiation therapy and targeted therapy, some patients are considering alternative therapies with herbal/natural products. In
Fanjie Meng et al.
Oncology reports, 32(5), 2023-2030 (2014-09-06)
Ras mutations contribute to human cancer development. The present study assessed the Ras V12 mutation in hepatocellular carcinoma (HCC) cells and the role of its silencing in vitro and in nude mouse xenografts. HCC BEL7402 cells expressed mutations of V12 (Val/Gly)
Francesco Baschieri et al.
Nature communications, 5, 4839-4839 (2014-09-12)
The small GTPase Cdc42 is a key regulator of polarity, but little is known in mammals about its spatial regulation and the relevance of spatial Cdc42 pools for polarity. Here we report the identification of a GM130-RasGRF complex as a