Skip to Content
Merck

EHU073951

MISSION® esiRNA

targeting human PAK4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGAGTATCCCATGAGCAGTTCCGGGCTGCCCTGCAGCTGGTGGTGGACCCAGGCGACCCCCGCTCCTACCTGGACAACTTCATCAAGATTGGCGAGGGCTCCACGGGCATCGTGTGCATCGCCACCGTGCGCAGCTCGGGCAAGCTGGTGGCCGTCAAGAAGATGGACCTGCGCAAGCAGCAGAGGCGCGAGCTGCTCTTCAACGAGGTGGTAATCATGAGGGACTACCAGCACGAGAATGTGGTGGAGATGTACAACAGCTACCTGGTGGGGGACGAGCTCTGGGTGGTCATGGAGTTCCTGGAAGGAGGCGCCCTCACCGACATCGTCACCCACACCAGGATGAACGAGGAGCAGATCGCGGCCGTGTGCCTTGCAGTGCTGCAGGCCCTGTCGGTGCTCCACGCCCAGGGCGTCATCCACCGGGACATCAAGAGCGACTCGATCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PAK4(10298)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Shi-Xun Lu et al.
Cancer letters, 402, 71-80 (2017-06-05)
The dysregulation of transcription factors contributes to the unlimited growth of cancer cells. Zic2 has been shown to be crucial to the progression of human cancers. However, its role in hepatocellular carcinoma (HCC) remains unclear. Our data showed that Zic2
Xianghe Lu et al.
Oncology reports, 38(2), 1240-1250 (2017-07-06)
Glioma is an extremely aggressive and lethal type of brain tumour that originates from glial cells. MicroRNA (miRNA) dysregulation has been implicated in the occurrence and progression of many human cancers, including glioma. Thus, some specific miRNAs are potential therapeutic
Amro Aboukameel et al.
Molecular cancer therapeutics, 16(1), 76-87 (2017-01-08)
The p21-activated kinase 4 (PAK4) is a key downstream effector of the Rho family GTPases and is found to be overexpressed in pancreatic ductal adenocarcinoma (PDAC) cells but not in normal human pancreatic ductal epithelia (HPDE). Gene copy number amplification