Skip to Content
Merck

EHU035971

MISSION® esiRNA

targeting human MARCKS

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAACTACACTTGGGCTCCTTTTTTTGTGCTCGACTTTTCCACCCTTTTTCCCTCCCTCCTGTGCTGCTGCTTTTTGATCTCTTCGACTAAAATTTTTTTATCCGGAGTGTATTTAATCGGTTCTGTTCTGTCCTCTCCACCACCCCCACCCCCCTCCCTCCGGTGTGTGTGCCGCTGCCGCTGTTGCCGCCGCCGCTGCTGCTGCTCGCCCCGTCGTTACACCAACCCGAGGCTCTTTGTTTCCCCTCTTGGATCTGTTGAGTTTCTTTGTTGAAGAAGCCAGCATGGGTGCCCAGTTCTCCAAGACCGCAGCGAAGGGAGAAGCCGCCGCGGAGAGGCCTGGGGAGGCGGCTGTGGCCTCGTCGCCTTCCAAAGCGAACGGACAGGAGAATGGCCACGTGAAGGTAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MARCKS(4082)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Cuong Van Dao et al.
The Journal of veterinary medical science, 79(12), 1931-1938 (2017-10-20)
Methylmercury (MeHg) is an environmental pollutant that shows severe toxicity to humans and animals. However, the molecular mechanisms mediating MeHg toxicity are not completely understood. We have previously reported that the MARCKS protein is involved in the MeHg toxicity to
Jun Li et al.
Journal of Cancer, 10(11), 2480-2487 (2019-07-02)
Objective: Recently, accumulating evidence has indicated that the 3' untranslated regions (3'UTRs) of protein coding genes play critical roles in the progression of various cancers, including ovarian cancer. This study is aimed to identify the potential role of SNAI2-3'UTR in
Ching-Hsien Chen et al.
Oncotarget, 6(17), 15194-15208 (2015-05-28)
Accumulating evidence has suggested that myristoylated alanine-rich C-kinase substrate (MARCKS) is critical for regulating multiple pathophysiological processes. However, the molecular mechanism underlying increased phosphorylation of MARCKS at Ser159/163 (phospho-MARCKS) and its functional consequence in neoplastic disease remain to be established.