Skip to Content
Merck

EHU112501

MISSION® esiRNA

targeting human HSPB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HSPB1(3315)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Eva Hadadi et al.
Scientific reports, 6, 39035-39035 (2016-12-16)
Monocytes play a central role in regulating inflammation in response to infection or injury, and during auto-inflammatory diseases. Human blood contains classical, intermediate and non-classical monocyte subsets that each express characteristic patterns of cell surface CD16 and CD14; each subset
Ah-Mee Park et al.
PloS one, 11(2), e0148998-e0148998 (2016-02-10)
Heat shock protein 27 (HSP27) is a member of the small molecular weight HSP family. Upon treatment with transforming growth factor β1 (TGF-β1), we observed upregulation of HSP27 along with that of α-smooth muscle actin (α-SMA), a marker of myofibroblast
Jong-Rung Tsai et al.
PloS one, 9(3), e91331-e91331 (2014-03-13)
Heat-shock proteins (HSPs) are molecular chaperones that protect proteins from damage. HSP27 expression is associated with cancer transformation and invasion. Ginkgo biloba extract (EGb761), the most widely sold herbal supplement, has antiangiogenic effects and induces tumor apoptosis. Data regarding the