Skip to Content
Merck

EHU151811

MISSION® esiRNA

targeting human PIK3R1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGGCAAGGTTATATGCACTTTCTCATGATTTACAGAGAAGTGAATAACTGCAAAGTGAAGTTGCTTCTTCTACTTCAGTCTTCTCTCACTTTGATTTGCTAGTTGTTATCAATTAATGACAATTACAAACCTACTGTATCTCTAATACAGTGTGACTGGTCAGGTATTTCAGTTCTTAGGAAGGAAGTGCCAAGTTTGTTTTTGGGTTCCTGGAACAGCGCTCACCTTTGTTTAGAACACTGGTTTAAAGGGATAATCATCTCTGTCACATTAGACTATCCATCATGACCAGCAAATACTCATTTTAGGAAAAAAAAAAGCATGATCTGAAAAATACTTTTGGTGGTATGTTGGTTACCCTCCTAGCTTTCCATTTGGTTTAGAACATAAAGCAAATAGACACAGTCATACTGTCACTGCTCTGGACTGTGTGGAGCTCGCTAAAGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PIK3R1(5295)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xinran Li et al.
Nature communications, 10(1), 716-716 (2019-02-14)
Copy number loss of PIK3R1 (p85α) most commonly occurs in ovarian cancer among all cancer types. Here we report that ovarian cancer cells manifest a spectrum of tumorigenic phenotypes upon knockdown of PIK3R1. PIK3R1 loss activates AKT and p110-independent JAK2/STAT3
Reem Ali et al.
Cells, 8(10) (2019-10-23)
Ataxia-telegiectasia mutated (ATM), phosphatase and tensin homolog (PTEN), and p85α are key tumour suppressors. Whether ATM regulates PTEN expression and influence platinum sensitivity is unknown. We generated ATM knockdowns (KD) and CRISPR knock outs (KO) in glioblastoma (LN18, LN229) and
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed