Skip to Content
Merck

EMU041221

MISSION® esiRNA

targeting mouse Gpr109a

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTTGCTTCTTGTGGGGTCTCACCATCGGCCTGACTGTCCACCTCCTCTATACAAACATGATGACCAAAAATGGCGAGGCATATCTGTGTAGCAGCTTCAGCATCTGTTACAACTTCAGGTGGCACGATGCTATGTTCCTCTTGGAATTCTTCTTGCCCCTGGCCATCATCTTGTTCTGCTCAGGCAGGATCATCTGGAGCCTGAGGCAGAGACAGATGGACAGACATGCCAAGATCAAGAGGGCCATCAACTTCATCATGGTGGTGGCTATTGTATTCATCATTTGCTTCCTACCCAGTGTGGCTGTGCGCATCCGCATCTTCTGGCTTCTCTACAAATATAACGTACGCAACTGTGACATCTACTCCTCGGTGGACCTGGCTTTCTTTACCACCCTTAGCTTTACCTACATGAACAGCATGCTGGACCCTGTGGTCTACTATTTCTCCAGCCCATCTTTCCCCAACTTCTTCTCCACGTGTATCAACCGCTGCCTTCGAAAGAAAACATTGGGTGAACCCGATA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and
Banabihari Giri et al.
International journal of molecular sciences, 20(18) (2019-09-22)
In this study, we used macrophage RAW264.7 cells to elucidate the molecular mechanism underlying the anti-inflammatory actions of niacin. Anti-inflammatory actions of niacin and a possible role of its receptor GPR109A have been studied previously. However, the precise molecular mechanism
Genki Hayashi et al.
Human molecular genetics, 26(15), 2864-2873 (2017-05-02)
The induction of mitochondrial biogenesis could potentially alleviate mitochondrial and muscle disease. We show here that dimethyl fumarate (DMF) dose-dependently induces mitochondrial biogenesis and function dosed to cells in vitro, and also dosed in vivo to mice and humans. The