Skip to Content
Merck

EHU047751

MISSION® esiRNA

targeting human CX3CL1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACCTTCTGCCATCTGACTGTCCTGCTGGCTGGACAGCACCACGGTGTGACGAAATGCAACATCACGTGCAGCAAGATGACATCAAAGATACCTGTAGCTTTGCTCATCCACTATCAACAGAACCAGGCATCATGCGGCAAACGCGCAATCATCTTGGAGACGAGACAGCACAGGCTGTTCTGTGCCGACCCGAAGGAGCAATGGGTCAAGGACGCGATGCAGCATCTGGACCGCCAGGCTGCTGCCCTAACTCGAAATGGCGGCACCTTCGAGAAGCAGATCGGCGAGGTGAAGCCCAGGACCACCCCTGCCGCCGGGGGAATGGACGAGTCTGTGGTCCTGGAGCCCGAAGCCACAGGCGAAAGCAGTAGCCTGGAGCCGACTCCTTCTTCCCAGGAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CX3CL1(6376)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ju-Fang Liu et al.
Oncotarget, 8(33), 54136-54148 (2017-09-15)
Osteosarcoma is the most common primary bone tumor in children and teens. The exact molecular mechanism underlying osteosarcoma progression still remains unclear. The CX3CL1/fractalkine has been implicated in various tumors but not in osteosarcoma. This study is the first to
Claudia Geismann et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignant neoplasms and registers rising death rates in western countries. Due to its late detection in advanced stages, its extremely aggressive nature and the minimal effectiveness of currently available therapies
Feifei Ren et al.
Immunology and cell biology, 97(5), 457-469 (2018-12-24)
Mutations in the isocitrate dehydrogenase (IDH) 1 gene, especially the R132H mutation, have been reported to be associated with a better prognosis in glioma patients. However, the underlying molecular mechanisms are not yet well understood. Many factors may contribute to