Skip to Content
Merck

EHU058451

MISSION® esiRNA

targeting human ANXA3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGGACACCGAGGAACAGTAAGAGATTATCCAGACTTTAGCCCATCAGTGGATGCTGAAGCTATTCAGAAAGCAATCAGAGGAATTGGAACTGATGAGAAAATGCTCATCAGCATTCTGACTGAGAGGTCAAATGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCATATGGAAAGGAGCTGAAAGATGACTTGAAGGGTGATCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTAGTGACTCCACCAGCAGTCTTTGATGCAAAGCAGCTAAAGAAATCCATGAAGGGCGCGGGAACAAACGAAGATGCCTTGATTGAAATCTTAACTACCAGGACAAGCAGGCAAATGAAGGATATCTCTCAAGCCTATTATACAGTATACAAGAAGAGTCTTGGAGATGACATTAGTTCCGAAACATCTGGTGACTTCCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ANXA3(306)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ruisi Xu et al.
Journal of cellular biochemistry, 120(9), 14585-14593 (2019-04-19)
Colorectal cancer (CRC) is a common disease with high mortality and morbidity. Annexin A3 (ANXA3) belongs to the structurally homologous family of Ca2+ and phospholipid-binding proteins. This study aimed to investigate the effects and potential mechanisms of ANXA3 on oxaliplatin
S Y Yu et al.
Neoplasma, 61(3), 257-264 (2014-05-16)
Annexin A3 participates in various biological processes, including tumorigenesis, drug resistance, and metastasis. The aim of this study was to investigate the expression of Annexin A3 in gastric cancer and its relationship with cell differentiation, migration, and invasion of gastric
Stryder M Meadows et al.
PloS one, 10(7), e0132580-e0132580 (2015-07-17)
Annexins are a large family of calcium binding proteins that associate with cell membrane phospholipids and are involved in various cellular processes including endocytosis, exocytosis and membrane-cytoskeletal organization. Despite studies on numerous Annexin proteins, the function of Annexin A3 (Anxa3)