Skip to Content
Merck

EHU099201

MISSION® esiRNA

targeting human EDA2R

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCTCGCAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGTGTTCAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGAAAGACACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAGGTTCAATGTGCCTTCCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EDA2R(60401)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Mi Hee Kwack et al.
Biochemical and biophysical research communications, 529(3), 766-772 (2020-08-02)
Androgenetic alopecia (AGA) is a common genetic disorder, and a X-chromosomal locus that contains the androgen receptor (AR) and ectodysplasin A2 receptor (EDA2R) genes represents a major susceptibility locus for AGA. In our previous study, we reported that ectodysplasin-A2 (EDA-A2)
Margherita Sisto et al.
Clinical and experimental medicine, 17(1), 111-119 (2015-12-15)
Despite recent advancements in the knowledge of the etiology and pathogenic mechanisms, treatment of the autoimmune disease Sjögren's syndrome (SS) remains mostly empiric and symptom-based, indicating the need for novel therapeutic approaches. Ectodysplasin-A2 (EDA-A2) is a recently isolated member of
Xiqian Lan et al.
Biochimie, 174, 74-83 (2020-04-19)
EDA2R is a member of the large family of tumor necrosis factor receptor (TNFR). Previous studies suggested that EDA2R expression might be increased in the kidneys of diabetic mice. However, its mRNA and protein expression in kidneys were not analyzed;