Skip to Content
Merck

EHU147251

MISSION® esiRNA

targeting human EIF5A2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGTCATGCCAAGGTTCACCTTGTTGGAATTGATATTTTCACGGGCAAAAAATATGAAGATATTTGTCCTTCTACTCACAACATGGATGTTCCAAATATTAAGAGAAATGATTATCAACTGATATGCATTCAAGATGGTTACCTTTCCCTGCTGACAGAAACTGGTGAAGTTCGTGAGGATCTTAAACTGCCAGAAGGTGAACTAGGCAAAGAAATAGAGGGAAAATACAATGCAGGTGAAGATGTACAGGTGTCTGTCATGTGTGCAATGAGTGAAGAATATGCTGTAGCCATAAAACCCTGCAAATAAACGGAAACATCAGGCATGAACACTGTTTATGTCTGAATCAACTGCAGATCTAATTTGGTTCTAAGTTGTCACCAAAGCTATAGCCTTCATAAGCAACCTCATTTCTTTTTTTAATTGTTTTCAGATTGTGCTGGGTTAGTTTTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EIF5A2(56648)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ying Bao et al.
International journal of biological sciences, 16(5), 827-837 (2020-02-20)
We investigated the role of microRNA (miR)-9 in modulating chemoresistance in hepatocellular carcinoma (HCC) cells. MiR-9 was overexpressed or knocked down in HCC cell lines. Cell viability, cell proliferation, the expression of EIF5A2 and the epithelial-mesenchymal transition (EMT)-related proteins were
Yu Liu et al.
Breast cancer (Tokyo, Japan), 22(6), 602-607 (2014-03-19)
The eIF5A2 gene (encoding the eukaryotic initiation factor 5A2) located at 3q26 is a putative oncogene that is overexpressed in colon and rectal carcinomas, lung cancer and hepatocellular carcinoma. EIF5A2 overexpression correlates significantly with tumor metastasis and is an adverse
Xiulong Zhong et al.
Bioengineered, 11(1), 619-627 (2020-06-12)
Overexpression of eukaryotic initiation factor- 5A2 (eIF5A2) has been implicated in promoting tumor cell migration and invasion in many cancers. However, whether eIF5A2 could be as the target for prostate cancer (PCa) treatment is still unknown. In this study, small