Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGGTCATGCCAAGGTTCACCTTGTTGGAATTGATATTTTCACGGGCAAAAAATATGAAGATATTTGTCCTTCTACTCACAACATGGATGTTCCAAATATTAAGAGAAATGATTATCAACTGATATGCATTCAAGATGGTTACCTTTCCCTGCTGACAGAAACTGGTGAAGTTCGTGAGGATCTTAAACTGCCAGAAGGTGAACTAGGCAAAGAAATAGAGGGAAAATACAATGCAGGTGAAGATGTACAGGTGTCTGTCATGTGTGCAATGAGTGAAGAATATGCTGTAGCCATAAAACCCTGCAAATAAACGGAAACATCAGGCATGAACACTGTTTATGTCTGAATCAACTGCAGATCTAATTTGGTTCTAAGTTGTCACCAAAGCTATAGCCTTCATAAGCAACCTCATTTCTTTTTTTAATTGTTTTCAGATTGTGCTGGGTTAGTTTTGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... EIF5A2(56648)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ying Bao et al.
International journal of biological sciences, 16(5), 827-837 (2020-02-20)
We investigated the role of microRNA (miR)-9 in modulating chemoresistance in hepatocellular carcinoma (HCC) cells. MiR-9 was overexpressed or knocked down in HCC cell lines. Cell viability, cell proliferation, the expression of EIF5A2 and the epithelial-mesenchymal transition (EMT)-related proteins were
Yu Liu et al.
Breast cancer (Tokyo, Japan), 22(6), 602-607 (2014-03-19)
The eIF5A2 gene (encoding the eukaryotic initiation factor 5A2) located at 3q26 is a putative oncogene that is overexpressed in colon and rectal carcinomas, lung cancer and hepatocellular carcinoma. EIF5A2 overexpression correlates significantly with tumor metastasis and is an adverse
Xiulong Zhong et al.
Bioengineered, 11(1), 619-627 (2020-06-12)
Overexpression of eukaryotic initiation factor- 5A2 (eIF5A2) has been implicated in promoting tumor cell migration and invasion in many cancers. However, whether eIF5A2 could be as the target for prostate cancer (PCa) treatment is still unknown. In this study, small