description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTTAGCACGGCTCTGGAAACACGCAAACCCTGGTGGTCCCATTTATTTCCTAAAGGGTCTGTCTCACCTCCACATCCTTAACTTGGAGTCCAACGGCTTTGACGAGATCCCAGTTGAGGTCTTCAAGGATTTATTTGAACTAAAGATCATCGATTTAGGATTGAATAATTTAAACACACTTCCAGCATCTGTCTTTAATAATCAGGTGTCTCTAAAGTCATTGAACCTTCAGAAGAATCTCATAACATCCGTTGAGAAGAAGGTTTTCGGGCCAGCTTTCAGGAACCTGACTGAGTTAGATATGCGCTTTAATCCCTTTGATTGCACGTGTGAAAGTATTGCCTGGTTTGTTAATTGGATTAACGAGACCCATACCAACATCCCTGAGCTGTCAAGCCACTACCTTTGCAACACTCCACCTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
human ... TLR3(7098)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Xiaoxiao Yu et al.
Cell journal, 22(3), 325-333 (2019-12-22)
This study aimed to evaluate the specific roles of polyinosinic:polycytidylic acid (polyI:C) in macrophage chemotaxis and reveal the potential regulatory mechanisms related to chemokine receptor 5 (CCR5). In this experimental study, THP-1-derived macrophages (THP1-Mφs) induced from THP- 1 monocytes were
Tadaatsu Imaizumi et al.
Journal of neuroimmunology, 324, 16-21 (2018-09-10)
Brain capillary endothelial cells are the component of blood brain barrier, and the first line of defense against viruses invading into brain. We demonstrate that treatment of hCMEC/D3 cells, a human brain capillary endothelial cell line, with a Toll-like receptor
Zengguang Xu et al.
Cancer cell international, 14, 80-80 (2014-01-01)
Therapeutic options for patients with non-small cell lung cancer (NSCLC) are often restricted to systemic chemotherapy. However, the molecular and cellular processes during chemotherapy of advanced NSCLC patients still remain unclear. Here we investigated the stimulatory activity of plasma in
Maya O Tree et al.
Virology, 497, 81-91 (2016-07-20)
Arboviruses are a large group of viruses that are transmitted by arthropods including ticks and mosquitoes. The global diversity of arboviruses is unknown; however, theoretical studies have estimated that over 2,000 mosquito-borne flaviviruses may exist. An increasing number of flaviviruses
Ye Liu et al.
Journal of cellular biochemistry, 120(6), 9532-9538 (2018-12-07)
To investigate the effect and mechanism of microRNA-186-5p (miR-186-5p) on the apoptosis in high glucose (HG)-treated cardiomyocytes. Diabetic cardiomyopathy model was established in cardiomyocytes by stimulating with HG. The expressions of miR-186-5p and toll-like receptor 3 (TLR3) were detected by
관련 콘텐츠
Instructions
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.