Skip to Content
Merck

EHU046551

MISSION® esiRNA

targeting human PRNP

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAGCGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCGAGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGAGGAAGGTCTTCCTGTTTTCACCATCTTTCTAATCTTTTTCCAGCTTGAGGGAGGCGGTATCCACCTGCAGCCCTTTTAGTGGTGGTGTCTCACTCTTTCTTCTCTCTTTGTCCCGGATAGGCTAATCAATACCCTTGGCACTGATGGGCACTGGAAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRNP(5621)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Jin-Young Park et al.
Oncotarget, 6(7), 5342-5353 (2015-03-07)
Hypoxia decreases cytotoxic responses to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) protein. Cellular prion protein (PrPc) is regulated by HIF-1α in neurons. We hypothesized that PrPc is involved in hypoxia-mediated resistance to TRAIL-induced apoptosis. We found that hypoxia induced PrPc
Yong-Seok Han et al.
Cell death & disease, 7(10), e2395-e2395 (2016-10-07)
Mesenchymal stem cells (MSCs) are 'adult' multipotent cells that promote regeneration of injured tissues in vivo. However, differences in oxygenation levels between normoxic culture conditions (21% oxygen) and both the MSC niche (2-8% oxygen) and ischemic injury-induced oxidative stress conditions
Heather Bender et al.
PloS one, 14(7), e0219995-e0219995 (2019-07-23)
Prion diseases are members of neurodegenerative protein misfolding diseases (NPMDs) that include Alzheimer's, Parkinson's and Huntington diseases, amyotrophic lateral sclerosis, tauopathies, traumatic brain injuries, and chronic traumatic encephalopathies. No known therapeutics extend survival or improve quality of life of humans