Skip to Content
Merck

EHU123791

MISSION® esiRNA

targeting human PRKDC

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCGACTTGCGTGTGATGTTGATCAGGTGACAAGGCAACTGTATGAGCCACTAGTTATGCAGCTGATTCACTGGTTCACTAACAACAAGAAATTTGAAAGTCAGGATACTGTTGCCTTACTAGAAGCTATATTGGATGGAATTGTGGACCCTGTTGACAGTACTTTAAGAGATTTTTGTGGTCGGTGTATTCGAGAATTCCTTAAATGGTCCATTAAGCAAATAACACCACAGCAGCAGGAGAAGAGTCCAGTAAACACCAAATCGCTTTTCAAGCGACTTTATAGCCTTGCGCTTCACCCCAATGCTTTCAAGAGGCTGGGAGCATCACTTGCCTTTAATAATATCTACAGGGAATTCAGGGAAGAAGAGTCTCTGGTGGAACAGTTTGTGTTTGAAGCCTTGGTGATATACATGGAGAGTCTGGCCTTAGCACATGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRKDC(5591)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Sonia Paget et al.
Oncotarget, 8(2), 2916-2935 (2016-12-10)
The tumor suppressor gene HIC1 (Hypermethylated In Cancer 1) encodes a transcriptional repressor mediating the p53-dependent apoptotic response to irreparable DNA double-strand breaks (DSBs) through direct transcriptional repression of SIRT1. HIC1 is also essential for DSB repair as silencing of
Xing-Mei Liang et al.
Acta pharmacologica Sinica, 42(4), 648-654 (2021-01-09)
The third-generation of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), represented by osimertinib, has achieved remarkable clinical outcomes in the treatment of non-small-cell lung cancer (NSCLC) with EGFR mutation. However, resistance eventually emerges in most patients and the underlying
Lin Jia et al.
The Journal of pathology, 243(2), 255-266 (2017-08-05)
Endostatin was discovered as an endogenous angiogenesis inhibitor with broad-spectrum antitumour activities. Although clinical efficacy was observed when endostatin was combined with standard chemotherapy for non-small cell lung cancer (NSCLC), as well as other cancer types, the specific mechanisms underlying