Skip to Content
Merck

EHU049051

MISSION® esiRNA

targeting human XRN2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATGCTAGTGCTCCTGGTGAAGGAGAACATAAAATCATGGATTACATTAGAAGGCAAAGAGCCCAGCCTAACCATGACCCAAATACTCATCATTGTTTATGTGGAGCAGATGCTGATCTCATTATGCTTGGCCTTGCCACACATGAACCGAACTTTACCATTATTAGAGAAGAATTCAAACCAAACAAGCCCAAACCATGTGGTCTTTGTAATCAGTTTGGACATGAGGTCAAAGATTGTGAAGGTTTGCCAAGAGAAAAGAAGGGAAAGCATGATGAACTTGCCGATAGTCTTCCTTGTGCAGAAGGAGAGTTTATCTTCCTTCGGCTTAATGTTCTTCGTGAGTATTTGGAAAGAGAACTCACAATGGCCAGCCTACCATTCACATTTGATGTTGAGAGGAGCATTGATGACTGGGTTTTCATGTGCTTCTTTGTGGGAAATGACTTCCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Praveen L Patidar et al.
Scientific reports, 10(1), 14253-14253 (2020-08-30)
Persistent R-loops (RNA-DNA hybrids with a displaced single-stranded DNA) create DNA damage and lead to genomic instability. The 5'-3'-exoribonuclease 2 (XRN2) degrades RNA to resolve R-loops and promotes transcription termination. Previously, XRN2 was implicated in DNA double strand break (DSB)
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Jong-Sun Lee et al.
Molecular cell, 77(5), 1044-1054 (2020-01-12)
Antisense oligonucleotides (ASOs) that trigger RNase-H-mediated cleavage are commonly used to knock down transcripts for experimental or therapeutic purposes. In particular, ASOs are frequently used to functionally interrogate long noncoding RNAs (lncRNAs) and discriminate lncRNA loci that produce functional RNAs
Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
Oussama Meziane et al.
Scientific reports, 5, 16688-16688 (2015-11-21)
The decapping scavenger enzyme DcpS is known for its role in hydrolyzing the cap structure following mRNA degradation. Recently, we discovered a new function in miRNA degradation activation for the ortholog of DcpS in C. elegans. Here we show that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service