Skip to Content
Merck

EHU067421

MISSION® esiRNA

targeting human LRP1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTACTGCAACAGCAGCTTTCAGCTTCAGGCAGATGGCAAGACCTGCAAAGATTTTGATGAGTGCTCAGTGTACGGCACCTGCAGCCAGCTATGCACCAACACAGACGGCTCCTTCATATGTGGCTGTGTTGAAGGATACCTCCTGCAGCCGGATAACCGCTCCTGCAAGGCCAAGAACGAGCCAGTAGACCGGCCCCCTGTGCTGTTGATAGCCAACTCCCAGAACATCTTGGCCACGTACCTGAGTGGGGCCCAGGTGTCTACCATCACACCTACGAGCACGCGGCAGACCACAGCCATGGACTTCAGCTATGCCAACGAGACCGTATGCTGGGTGCATGTTGGGGACAGTGCTGCTCAGACGCAGCTCAAGTGTGCCCGCATGCCTGGCCTAAAGGGCTTCGTGGATGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jianhua Peng et al.
Redox biology, 21, 101121-101121 (2019-02-01)
White matter injury (WMI) is associated with motor deficits and cognitive dysfunctions in subarachnoid hemorrhage (SAH) patients. Therapeutic strategy targeting WMI would likely improve the neurological outcomes after SAH. Low-density lipoprotein receptor-related protein-1 (LRP1), a scavenger receptor of apolipoprotein E
Aline Appert-Collin et al.
Cell adhesion & migration, 11(4), 316-326 (2016-07-28)
The low-density lipoprotein receptor-related protein-1 (LRP-1) is a member of Low Density Lipoprotein Receptor (LDLR) family, which is ubiquitously expressed and which is described as a multifunctional endocytic receptor which mediates the clearance of various extracellular matrix molecules including serine
Tomoya Kitakaze et al.
Biochimica et biophysica acta. Molecular cell research, 1867(2), 118563-118563 (2019-11-02)
Skeletal muscle secretes biologically active proteins that contribute to muscle hypertrophy in response to either exercise or dietary intake. The identification of skeletal muscle-secreted proteins that induces hypertrophy can provide critical information regarding skeletal muscle health. Dietary provitamin A, β-carotene
Ling Lin et al.
Oncotarget, 8(50), 88094-88103 (2017-11-21)
Macrophage accumulation is one of the hallmarks of progressive kidney disease. In response to injury, macrophages undergo a phenotypic polarization to become two functionally distinct subsets: M1 and M2 macrophages. Macrophage polarization is a dynamic process, and recent work indicates
Paola Merino et al.
The Journal of biological chemistry, 292(7), 2741-2753 (2016-12-18)
Axonal injury is a common cause of neurological dysfunction. Unfortunately, in contrast to axons from the peripheral nervous system, the limited capacity of regeneration of central nervous system (CNS) axons is a major obstacle for functional recovery in patients suffering

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service