Skip to Content
Merck

EHU070981

MISSION® esiRNA

targeting human E2F1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCTCTCCTCTGTCTCCAGAAGCTTCTAGCTCTGGGGTCTGGCTACCGCTAGGAGGCTGAGCAAGCCAGGAAGGGAAGGAGTCTGTGTGGTGTGTATGTGCATGCAGCCTACACCCACACGTGTGTACCGGGGGTGAATGTGTGTGAGCATGTGTGTGTGCATGTACCGGGGAATGAAGGTGAACATACACCTCTGTGTGTGCACTGCAGACACGCCCCAGTGTGTCCACATGTGTGTGCATGAGTCCATGTGTGCGCGTGGGGGGGCTCTAACTGCACTTTCGGCCCTTTTGCTCTGGGGGTCCCACAAGGCCCAGGGCAGTGCCTGCTCCCAGAATCTGGTGCTCTGACCAGGCCAGGTGGGGAGGCTTTGGCTGGCTGGGCGTGTAGGACGGTGAGAGCACTTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... E2F1(1869)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Qian Li et al.
Cell death & disease, 11(9), 757-757 (2020-09-17)
Despite the ubiquitous mechanical cues at both spatial and temporal dimensions, cell identities and functions are largely immune to the everchanging mechanical stimuli. To understand the molecular basis of this epigenetic stability, we interrogated compressive force-elicited transcriptomic changes in mesenchymal
Juan Liu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(2), 2673-2682 (2015-09-26)
Cancerous inhibitor of protein phosphatase 2A (CIP2A) is a recently identified oncoprotein. Here, we investigated its role in the formation of multidrug resistance (MDR) of cervical adenocarcinoma in vitro and in vivo. MTT assay showed that knockdown of CIP2A expression
Jung-Jyh Hung et al.
Experimental hematology & oncology, 1(1), 18-18 (2012-12-06)
The transcription factor E2F1 has been implicated in cell cycle control and DNA damage response. Paradoxically, E2F1 can promote apoptosis and function as tumor suppressor. In non-small cell lung cancer (NSCLC), there are conflicting data for clinical significance of E2F1