Skip to Content
Merck

EHU082301

MISSION® esiRNA

targeting human OGT

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAAACTGCAGGAAGCTCTGATGCATTATAAGGAGGCTATTCGAATCAGTCCTACCTTTGCTGATGCCTACTCTAATATGGGAAACACTCTAAAGGAGATGCAGGATGTTCAGGGAGCCTTGCAGTGTTATACGCGTGCCATCCAAATTAATCCTGCATTTGCAGATGCACATAGCAATCTGGCTTCCATTCATAAGGATTCAGGGAATATTCCAGAAGCCATAGCTTCTTACCGCACGGCTCTGAAACTTAAGCCTGATTTTCCTGATGCTTATTGTAACTTGGCTCATTGCCTGCAGATTGTCTGTGATTGGACAGACTATGATGAGCGAATGAAGAAGTTGGTCAGTATTGTGGCTGACCAGTTAGAGAAGAATAGGTTGCCTTCTGTGCATCCTCATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... OGT(8473)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Bing Zhang et al.
American journal of cancer research, 7(6), 1337-1349 (2017-07-04)
Abnormal cellular energetics has emerged as a hallmark of cancer cells. Deregulating aerobic glycolysis can alter multiple metabolic and signaling pathways in cancer cells, and trigger unlimited growth and proliferation. Accumulating evidence suggests that elevated levels of protein modification with
Ewa Forma et al.
PloS one, 13(6), e0198351-e0198351 (2018-06-05)
Enhancer of zest homolog 2 (EZH2) is a histone methyltransferase which plays a crucial role in cancer progression by regulation of genes involved in cellular processes such as proliferation, invasion and self-renewal. Activity and biological function of EZH2 are regulated
Lan V Pham et al.
Oncotarget, 7(49), 80599-80611 (2016-10-08)
The hexosamine biosynthetic pathway (HBP) requires two key nutrients glucose and glutamine for O-linked N-acetylglucosamine (O-GlcNAc) cycling, a post-translational protein modification that adds GlcNAc to nuclear and cytoplasmic proteins. Increased GlcNAc has been linked to regulatory factors involved in cancer