Skip to Content
Merck

EHU085781

MISSION® esiRNA

targeting human ATG5

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTATTTGCCTGAACAGAATCATCCTTAAATGGGATTTATCAGAGCATGTCACCCTTTTGCTTCAATCAGGTTTGGTGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCAGACAGGAAAAAGATTCCATGTCAGATAAGGCAACTGGGCTGGTCTTACTTTGCATCACCTCTGCTTTCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATG5(9474)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

ATG5 (autophagy protein 5) is involved in the formation of autophagosomes. It is part of the E3-like ATG12-ATG5-ATG16 complex, which is involved with autophagic vesicle formation and expansion. ATG5 is also needed for antigen presentation and thereby enhances viral clearance. Mutation in this gene decreases autophagy, thereby causing ataxia with developmental delay. The ATG5 gene is upregulated in systemic lupus erythematosus. It is also associated with Behçet′s disease. Polymorphisms in this gene are linked with neutrophilic airway inflammation, particularly in adult asthma.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Association of autophagy related gene polymorphisms with neutrophilic airway inflammation in adult asthma.
Pham DL
The Korean Journal of Internal Medicine, 31, 375-375 (2016)
Detecting Genetic Associations between ATG5 and Lupus Nephritis by trans-eQTL.
Zhang YM
Journal of immunology research, 2015, 153132-153132 (2015)
Mutation in ATG5 reduces autophagy and leads to ataxia with developmental delay.
Kim M
eLife, 5, e12245-e12245 (2016)