Skip to Content
Merck

EMU209401

MISSION® esiRNA

targeting mouse Dnm2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCCTTGAGAAGAGGCTATATCGGCGTGGTTAACCGAAGCCAGAAAGACATCGAGGGCAAAAAGGACATCCGGGCTGCTCTGGCAGCCGAGAGGAAATTCTTCCTCTCCCACCCAGCCTACCGGCACATGGCTGACCGCATGGGCACCCCACACTTGCAGAAAACCCTGAACCAGCAACTGACCAACCACATCCGAGAGTCACTGCCGACCCTTCGCAGCAAGCTGCAGAGCCAACTGCTGTCCCTGGAGAAGGAAGTGGAAGAGTACAAGAATTTCCGGCCTGATGACCCCACGCGCAAGACCAAAGCCCTGCTGCAGATGGTTCAGCAGTTTGGAGTGGACTTTGAGAAGCGAATTGAAGGCTCGGGAGATCAAGTAGACACACTAGAGTTGTCTGGTGGAGCCCGCATCAATCGTATCTTTCATGAGCGCTTTCCCTTTGAACTGGTAAAGATGGAGTTTGATGAGAAAGATCTACGAAGAGAGATCAGCTATGCTATTAAGAACATCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Anastasia Mashukova et al.
Molecular biology of the cell, 23(9), 1664-1674 (2012-03-09)
Phosphorylation of the activation domain of protein kinase C (PKC) isoforms is essential to start a conformational change that results in an active catalytic domain. This activation is necessary not only for newly synthesized molecules, but also for kinase molecules
Kenji Tanabe et al.
The Journal of cell biology, 185(6), 939-948 (2009-06-17)
Dynamin is a fission protein that participates in endocytic vesicle formation. Although dynamin was originally identified as a microtubule-binding protein, the physiological relevance of this function was unclear. Recently, mutations in the ubiquitously expressed dynamin 2 (dyn2) protein were found
Nah-Young Shin et al.
The Journal of cell biology, 207(1), 73-89 (2014-10-08)
Cell-cell fusion is an evolutionarily conserved process that leads to the formation of multinucleated myofibers, syncytiotrophoblasts and osteoclasts, allowing their respective functions. Although cell-cell fusion requires the presence of fusogenic membrane proteins and actin-dependent cytoskeletal reorganization, the precise machinery allowing