Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAAGATCGTGATCGTCATGGAGTATGCCAGCCGGGGCGACCTTTATGACTACATCAGCGAGCGGCAGCAGCTCAGTGAGCGCGAAGCTAGGCATTTCTTCCGGCAGATCGTCTCTGCCGTGCACTATTGCCATCAGAACAGAGTTGTCCACCGAGATCTCAAGCTGGAGAACATCCTCTTGGATGCCAATGGGAATATCAAGATTGCTGACTTCGGTCTCTCCAACCTCTACCATCAAGGCAAGTTCCTGCAGACATTCTGTGGGAGCCCCCTCTATGCCTCGCCAGAGATTGTCAATGGGAAGCCCTACACAGGCCCAGAGGTGGACAGCTGGTCCCTGGGTGTTCTCCTCTACATCCTGGTGCATGGCACCATGCCCTTTGATGGGCATGACCATAAGATCCTAGTGAAACAGATCAGCAACGGGGCCTACCGGGAGCCACCTAAACCCTCTGATGCCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NUAK2(81788)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Devon E Mason et al.
The Journal of cell biology, 218(4), 1369-1389 (2019-02-10)
Cell migration initiates by traction generation through reciprocal actomyosin tension and focal adhesion reinforcement, but continued motility requires adaptive cytoskeletal remodeling and adhesion release. Here, we asked whether de novo gene expression contributes to this cytoskeletal feedback. We found that
Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Mandeep K Gill et al.
Nature communications, 9(1), 3510-3510 (2018-08-31)
In most solid tumors, the Hippo pathway is inactivated through poorly understood mechanisms that result in the activation of the transcriptional regulators, YAP and TAZ. Here, we identify NUAK2 as a YAP/TAZ activator that directly inhibits LATS-mediated phosphorylation of YAP/TAZ