Skip to Content
Merck

EHU044071

MISSION® esiRNA

targeting human CASP8AP2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGTTCATCCTGATGTGTTGGATGAAAGTTGTATGTTTGAAGTGTCTACTAACCTACCTTTAAGTAAAGATAATGTGTGTAGTGTAGAAAAGAGCAAGCCCTGCGTTTCTTCCATACTTCTTGAAGATCTAGCAGTCTCTTTAACAGTACCATCGCCTCTGAAGTCAGATGGTCATCTCAGTTTTTTAAAGCCTGATATGTCGTCCAGTTCAACTCCTGAAGAAGTCATTAGTGCTCATTTTAGTGAAGATGCCTTACTTGAGGAAGAGGATGCATCTGAGCAAGATATTCATTTAGCTCTGGAGTCTGATAATTCAAGCAGTAAATCAAGTTGTTCTTCTTCCTGGACAAGCCGATCTGTTGCTCCAGGCTTTCAGTACCACCCTAATCTACCTATGCATGCCGTCATAATGGAAAAGTCCAATGATCATTTCATTGTGAAAATACGACGTGCAACACCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that
Takahiro Hirano et al.
PloS one, 10(7), e0133205-e0133205 (2015-07-25)
Dysregulation of the cell proliferation has been implicated in the pathophysiology of a number of diseases. Cellular senescence limits proliferation of cancer cells, preventing tumorigenesis and restricting tissue damage. However, the role of cellular senescence in proliferative nephritis has not

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service