Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCAGATCATGAAGAAGCTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATCGTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGAGCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTACATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAATGGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTACACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTACGGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FYN(2534)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jing Zheng et al.
Cancer biotherapy & radiopharmaceuticals, 32(9), 320-326 (2017-11-16)
Tyrosine kinase FYN-a member of the SRC family of kinases-is associated with mediating mitogenic signals and regulating cell cycle entry, growth, and proliferation. It was hypothesized that FYN is upregulated in thyroid carcinoma, which plays a critical role in tumorigenesis.
Michaela Nelson et al.
International journal of cancer, 135(10), 2338-2351 (2014-04-15)
Voltage-gated Na(+) channels (VGSCs) are heteromeric proteins composed of pore-forming α subunits and smaller β subunits. The β subunits are multifunctional channel modulators and are members of the immunoglobulin superfamily of cell adhesion molecules (CAMs). β1, encoded by SCN1B, is
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that